View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0925_low_136 (Length: 215)

Name: NF0925_low_136
Description: NF0925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0925_low_136
NF0925_low_136
[»] chr8 (1 HSPs)
chr8 (1-131)||(43193426-43193556)


Alignment Details
Target: chr8 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 1 - 131
Target Start/End: Original strand, 43193426 - 43193556
Alignment:
1 caaatggcgaagcagctaccttgtgacgccgatggtgtttgcatggcgtgtaaaacgaagcctctagaaactgaaacccttcattgtcgaacatgtgcaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43193426 caaatggcgaagcagctaccttgtgacgccgatggtgtttgcatggcgtgtaaaacgaagcctctagaaactgaaacccttcattgtcgaacatgtgcaa 43193525  T
101 ctccatggcatgttccttgtttacctatgat 131  Q
    |||||||||||||||||||||||||| ||||    
43193526 ctccatggcatgttccttgtttacctctgat 43193556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University