View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0925_low_136 (Length: 215)
Name: NF0925_low_136
Description: NF0925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0925_low_136 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 1 - 131
Target Start/End: Original strand, 43193426 - 43193556
Alignment:
| Q |
1 |
caaatggcgaagcagctaccttgtgacgccgatggtgtttgcatggcgtgtaaaacgaagcctctagaaactgaaacccttcattgtcgaacatgtgcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43193426 |
caaatggcgaagcagctaccttgtgacgccgatggtgtttgcatggcgtgtaaaacgaagcctctagaaactgaaacccttcattgtcgaacatgtgcaa |
43193525 |
T |
|
| Q |
101 |
ctccatggcatgttccttgtttacctatgat |
131 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |
|
|
| T |
43193526 |
ctccatggcatgttccttgtttacctctgat |
43193556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1088 times since January 2019
Visitors: 6709