View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0925_low_141 (Length: 202)
Name: NF0925_low_141
Description: NF0925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0925_low_141 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 99; Significance: 4e-49; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 99; E-Value: 4e-49
Query Start/End: Original strand, 1 - 123
Target Start/End: Complemental strand, 8173182 - 8173060
Alignment:
| Q |
1 |
ggatagcttatgaaaaaccttatatttacatnnnnnnnngtttgaatttatttatcttttattgtagaaatggtttgtacataagctcttgtataatata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8173182 |
ggatagcttatgaaaaaccttatatttacataaaaagaagtttgaatttatttatcttttattgtagaaatggtttgtacataagctcttgtataatata |
8173083 |
T |
 |
| Q |
101 |
agctcatatggtaagagcctatg |
123 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
8173082 |
agctcatatggtaagagcctatg |
8173060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 51 - 94
Target Start/End: Complemental strand, 32172625 - 32172582
Alignment:
| Q |
51 |
tttatcttttattgtagaaatggtttgtacataagctcttgtat |
94 |
Q |
| |
|
|||||||||| |||||||||| |||| ||||||||||||||||| |
|
|
| T |
32172625 |
tttatcttttgttgtagaaatagtttatacataagctcttgtat |
32172582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University