View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0925_low_67 (Length: 340)

Name: NF0925_low_67
Description: NF0925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0925_low_67
NF0925_low_67
[»] chr5 (1 HSPs)
chr5 (74-228)||(43182929-43183083)
[»] chr4 (1 HSPs)
chr4 (7-47)||(9452967-9453007)
[»] chr1 (1 HSPs)
chr1 (7-47)||(46424154-46424194)


Alignment Details
Target: chr5 (Bit Score: 151; Significance: 7e-80; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 151; E-Value: 7e-80
Query Start/End: Original strand, 74 - 228
Target Start/End: Original strand, 43182929 - 43183083
Alignment:
74 aaaaggtcgtggtcctcttgggacaattctcattttgcaacaagctaggtcacattgtggaacaatgttattctaagcatggtacaagccaaaaaattcg 173  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43182929 aaaaggtcgtggtcctcttgggacaattctcattttgcaacaagctaggtcacattgtggaacaatgttattctaagcatggtacaagccaaaaaattcg 43183028  T
174 gattatatcaattataataccatttatgatgataatgtaaattccactgctctta 228  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
43183029 gattatatcaattataatactatttatgatgataatgtaaattccactgctctta 43183083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 7 - 47
Target Start/End: Original strand, 9452967 - 9453007
Alignment:
7 tatatttaatgaattcaccgcttcatcataaaagagcaaca 47  Q
    ||||||||||||||| ||||||||||| |||||||||||||    
9452967 tatatttaatgaatttaccgcttcatcttaaaagagcaaca 9453007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 7 - 47
Target Start/End: Original strand, 46424154 - 46424194
Alignment:
7 tatatttaatgaattcaccgcttcatcataaaagagcaaca 47  Q
    ||||||||||||||||| ||||||||| |||||||||||||    
46424154 tatatttaatgaattcatcgcttcatcttaaaagagcaaca 46424194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University