View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0925_low_71 (Length: 331)
Name: NF0925_low_71
Description: NF0925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0925_low_71 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 92; Significance: 1e-44; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 156 - 251
Target Start/End: Original strand, 2243932 - 2244027
Alignment:
| Q |
156 |
tttatagaaaaaggatgttacattattcacaactattggatcagtcaaaggcttaataaacttgcgcgccaagtttcgtcaggcttacgggagtat |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2243932 |
tttatagaaaaaggatgttacattattcacaactattggatcagtcaaaggcttaataaacttgcgcgccaagttttgtcaggcttacgggagtat |
2244027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 74; Significance: 6e-34; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 114 - 251
Target Start/End: Original strand, 31780640 - 31780775
Alignment:
| Q |
114 |
ttaccaaaatctgtggcatgnnnnnnntgtaaaagcaacacgtttatagaaaaaggatgttacattattcacaactattggatcagtcaaaggcttaata |
213 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| ||||| ||||| |||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
31780640 |
ttaccaaaatctgtggcatgaaaaaaatgtaaaagcaacatgtttaaagaaa--ggatgttacactattcacaactattggatcactcaaaggcttaata |
31780737 |
T |
|
| Q |
214 |
aacttgcgcgccaagtttcgtcaggcttacgggagtat |
251 |
Q |
| |
|
|||||| | |||||||||||||||| |||||| ||||| |
|
|
| T |
31780738 |
aacttgtgtgccaagtttcgtcaggtttacggaagtat |
31780775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 163 - 251
Target Start/End: Complemental strand, 29059349 - 29059261
Alignment:
| Q |
163 |
aaaaaggatgttacattattcacaactattggatcagtcaaaggcttaataaacttgcgcgccaagtttcgtcaggcttacgggagtat |
251 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||| |||||| || |||||| |||||||||||| |||||| ||| |||||||| |
|
|
| T |
29059349 |
aaaaaggatgctacattattcacaataattggatcagtggaaggctaaagaaacttacgcgccaagttttgtcaggtttatgggagtat |
29059261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 573 times since January 2019
Visitors: 6705