View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0925_low_79 (Length: 320)
Name: NF0925_low_79
Description: NF0925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0925_low_79 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 37; Significance: 0.000000000007; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 192 - 228
Target Start/End: Complemental strand, 26954965 - 26954929
Alignment:
Q |
192 |
gttatatttgaacacactagttaaccatgtatgtatt |
228 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |
|
|
T |
26954965 |
gttatatttgaacacactagttaaccatgtatgtatt |
26954929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 136 - 173
Target Start/End: Complemental strand, 26955059 - 26955022
Alignment:
Q |
136 |
cattcaatagataactaaagaatatataaaattgtcgc |
173 |
Q |
|
|
|||||||||||||||||| ||||||||||||||||||| |
|
|
T |
26955059 |
cattcaatagataactaatgaatatataaaattgtcgc |
26955022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 450 times since January 2019
Visitors: 6703