View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0925_low_79 (Length: 320)

Name: NF0925_low_79
Description: NF0925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0925_low_79
NF0925_low_79
[»] chr4 (2 HSPs)
chr4 (192-228)||(26954929-26954965)
chr4 (136-173)||(26955022-26955059)


Alignment Details
Target: chr4 (Bit Score: 37; Significance: 0.000000000007; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 192 - 228
Target Start/End: Complemental strand, 26954965 - 26954929
Alignment:
192 gttatatttgaacacactagttaaccatgtatgtatt 228  Q
    |||||||||||||||||||||||||||||||||||||    
26954965 gttatatttgaacacactagttaaccatgtatgtatt 26954929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 136 - 173
Target Start/End: Complemental strand, 26955059 - 26955022
Alignment:
136 cattcaatagataactaaagaatatataaaattgtcgc 173  Q
    |||||||||||||||||| |||||||||||||||||||    
26955059 cattcaatagataactaatgaatatataaaattgtcgc 26955022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University