View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0925_low_81 (Length: 317)
Name: NF0925_low_81
Description: NF0925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0925_low_81 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 1e-93; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 120 - 301
Target Start/End: Original strand, 27302626 - 27302807
Alignment:
| Q |
120 |
aattgattggtatagtcaatagtgttatggtcggagaaattcacatttattcgtagatgatgttgtgctcaacatgggtgtggcatttttccctatataa |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27302626 |
aattgattggtatagtcaatagtgttatggtcggagacattcacatttattcgtagatgatgttgtgctcaacatgggtgtggcatttttccctatataa |
27302725 |
T |
 |
| Q |
220 |
aatacagcttctagacatgtattgctacactgttatgtgtcatttctaatgttgatcaattacaaatatttcatcactatta |
301 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27302726 |
aatacagcttctaaacatgtattgctacactgttatgtgtcatttctaatgttgatcaattacaaatatttcatcactatta |
27302807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 30 - 71
Target Start/End: Original strand, 27302304 - 27302345
Alignment:
| Q |
30 |
ctctgctgacatggtcatggggatggtgaccgatttatagag |
71 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27302304 |
ctctgctgacatggtcatggggatggtgaccgatttatagag |
27302345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University