View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0925_low_85 (Length: 312)
Name: NF0925_low_85
Description: NF0925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0925_low_85 |
 |  |
|
[»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 277; Significance: 1e-155; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 13 - 312
Target Start/End: Complemental strand, 21114576 - 21114276
Alignment:
Q |
13 |
aatatttgccatcaaataaagacaacctgataacagaatcgtgtacacaaatcagtcaaagatccatcattacggtatatatggtttggtcacttaattt |
112 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
21114576 |
aatatttgccatcaaataaagacaacctgataacagaatcgtgtacacaaattagtcaaagatccatcattacggtaaatatggtttggtcacttaattt |
21114477 |
T |
 |
Q |
113 |
cttgatgacaaagaaacatgttagtgcttgtcatgtacaaaatatatgtgaaaaataca-ggtatagtgtcaaattttagtgtcagtctcagattagtga |
211 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||| ||||||||||||| |
|
|
T |
21114476 |
cttgatgacaaagaaacatgttagtgcttgtcatgtacaaaatatatgtgaaaaatacagggtatagtgtcaaattttagtctcaggctcagattagtga |
21114377 |
T |
 |
Q |
212 |
aaaatacaaaaggccaactttgtagttggaataagttgtctaatttaagcaataagattgagccttgtttggactgcaacaaataaattttatcatagat |
311 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
21114376 |
aaaatacaaaaggccaactttgtagttggaataagttgtctaatttaagcaataagattgagccttgtttggactgcaacaaataaattttatcatagat |
21114277 |
T |
 |
Q |
312 |
a |
312 |
Q |
|
|
| |
|
|
T |
21114276 |
a |
21114276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 13 - 81
Target Start/End: Complemental strand, 21122003 - 21121935
Alignment:
Q |
13 |
aatatttgccatcaaataaagacaacctgataacagaatcgtgtacacaaatcagtcaaagatccatca |
81 |
Q |
|
|
||||||||||||||| ||||| ||||||||||| | |||| ||| |||||| |||||||||||| |||| |
|
|
T |
21122003 |
aatatttgccatcaagtaaaggcaacctgataatataatcatgtgcacaaaccagtcaaagatctatca |
21121935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 495 times since January 2019
Visitors: 6704