View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0925_low_89 (Length: 303)
Name: NF0925_low_89
Description: NF0925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0925_low_89 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 73 - 246
Target Start/End: Original strand, 39138984 - 39139157
Alignment:
| Q |
73 |
gtggcggcataggggatgatgatgatgataaaacagatgtgaagtgaagtaaagaagctgggtgtgtaatagtgtacatgaatgtgcattaatttaccta |
172 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39138984 |
gtggcggcataggtgatgatgatgatgataaaacagatgtgaagtgaagtaaagaagctgggtgtgtaatagtgtacatgaatgtgcattaatttaccta |
39139083 |
T |
|
| Q |
173 |
gcacatcaagaattaaaggtggttgttgagcaacgagccacacttgtgttctcttttcatagtgctctctgctc |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39139084 |
gcacatcaagaattaaaggtggttgttgagcaacgagccacacttgtgttctcttttcatagtgctctctgctc |
39139157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 724 times since January 2019
Visitors: 6705