View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0925_low_91 (Length: 291)
Name: NF0925_low_91
Description: NF0925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0925_low_91 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 10 - 262
Target Start/End: Complemental strand, 3678772 - 3678520
Alignment:
Q |
10 |
aataatatcaccaatttcatgtatagaaatcgcagcctctccataccctatggcctataccagcaaccaacatttaattctgtcattattggttcacctt |
109 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3678772 |
aataatatcaccaatttcatgtatagaaatcgcagcctctccataccctatggcctataccagcaaccaacatttaattctgtcattattggttcacctt |
3678673 |
T |
 |
Q |
110 |
aaaagtcttcttgttaagtgctagctgctatgatggagcattctgcagttggttgctccagtgcttaatgaacaaggactgatctaatctaagcgtaaca |
209 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3678672 |
aaaagtcttcttgttaagtgctagctgctatgatggagcattctgcagttggttgctccagtgcttaatgaacaaggactgatctaatctaagcgtaaca |
3678573 |
T |
 |
Q |
210 |
tattcaagcagttgccccaacaagcttaaattatttctttagtgggttaatga |
262 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3678572 |
tattcaagcagttgccccaacaagcttaaattatttctttagtgggttaatga |
3678520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University