View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0925_low_94 (Length: 287)
Name: NF0925_low_94
Description: NF0925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0925_low_94 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 114; Significance: 7e-58; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 16 - 225
Target Start/End: Original strand, 33187726 - 33187935
Alignment:
Q |
16 |
atcaaggaggaaagagtgaaaataactagcatcaagatgtannnnnnnnnnnnnnnnnaaaaaaggaggaaaaataacctgctttaagacgataatattt |
115 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||| ||| |
|
|
T |
33187726 |
atcaaggaggaaagagtgaaaataactagcatcaagatgtattttatttttattttttaaaaaaggaggaaaaataacctgctttgagacgataatcttt |
33187825 |
T |
 |
Q |
116 |
nnnnnnngatcccaattaatcctatactaacgaaagtcatgtcaataaacatagattttgacataactcaataccaacggaaacatatacagttagaacc |
215 |
Q |
|
|
||||||||| |||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
33187826 |
aacaaaagatcccaatgaatcctatactaacgaaactcatgtcaataaacataggttttgacataactcaataccaacggaaacatatatagttagaacc |
33187925 |
T |
 |
Q |
216 |
ggtatattgt |
225 |
Q |
|
|
|||||||||| |
|
|
T |
33187926 |
ggtatattgt |
33187935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1341 times since January 2019
Visitors: 6712