View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0925_low_96 (Length: 282)
Name: NF0925_low_96
Description: NF0925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0925_low_96 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 9 - 266
Target Start/End: Original strand, 51357730 - 51357986
Alignment:
| Q |
9 |
agcataggtttaactaatacataacgatttgcatcataatctagtgatggtgatacagacggactcacacgacacttgaagtttcaccatattgaagtta |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51357730 |
agcataggtttaactaatacataacgatttgcatcataatctagtgatggtgatacagagggactcacacgacacttgaagtttcaccatattgaagtt- |
51357828 |
T |
|
| Q |
109 |
nnnnnnnnnnggataaccttaaaatgcacactatgaattctaatatctctacttcccgtcatagacttgtatacatgaatattataactcatatatttgn |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51357829 |
ttttttttttggataaccttaaaatgcacactatgaattctaatatctctacttcccgtcatagacttgtatacatgaatattataactcatatatttgt |
51357928 |
T |
|
| Q |
209 |
nnnnnnattaattattgtaagattaaataactctccactccctttaaagataatgata |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51357929 |
ttttttattaattattgtaagattaaataactctccactccctttaaagataatgata |
51357986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 40 - 104
Target Start/End: Original strand, 34656907 - 34656972
Alignment:
| Q |
40 |
catcataatctagtgatggtgatacagacggactcacacgacact-tgaagtttcaccatattgaa |
104 |
Q |
| |
|
||||| || ||||||||||||||| ||| |||||||| ||| | | |||||||||||||||||||| |
|
|
| T |
34656907 |
catcagaaactagtgatggtgatagagagggactcacccgatattgtgaagtttcaccatattgaa |
34656972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 90 times since January 2019
Visitors: 6713