View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0926_high_17 (Length: 249)
Name: NF0926_high_17
Description: NF0926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0926_high_17 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 18 - 249
Target Start/End: Complemental strand, 43791092 - 43790861
Alignment:
| Q |
18 |
cttccaaagtactaatatttccaatttcacgaggcagtgatccaacaaaggtgttgttgttgagtacaagatctgtgaggttctgaagcttgtctatggt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43791092 |
cttccaaagtactaatatttccaatttcacgaggcagtgatccaacaaaggtgttgttgttgagtacaagatctgtgaggttctgaagcttgtctatggt |
43790993 |
T |
 |
| Q |
118 |
agatggaatttcactttcaaagctatttccagaaagatccaactgttgtattgaggaacagctgagtaactccaatggaaattttccagatagaatattt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43790992 |
agatggaatttcactttcaaagctatttccagaaagatccaactgttgtattgaggaacagctgagtaactccaatggaaattttccagatagaatattt |
43790893 |
T |
 |
| Q |
218 |
ctagccaagaaaagttgttgaagctttgaacc |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
43790892 |
ctagccaagaaaagttgttgaagctttgaacc |
43790861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University