View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0926_high_21 (Length: 211)
Name: NF0926_high_21
Description: NF0926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0926_high_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 159; Significance: 7e-85; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 29 - 187
Target Start/End: Original strand, 40451737 - 40451895
Alignment:
| Q |
29 |
atgaaagaatatggtgaagaatgttatcgggtaagtcactaatatttttctccattttgagtgatgatgattcattgatgagatttttcatcttttcgtg |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40451737 |
atgaaagaatatggtgaagaatgttatcgggtaagtcactaatatttttctccattttgagtgatgatgattcattgatgagatttttcatcttttcgtg |
40451836 |
T |
|
| Q |
129 |
taatgattcattgatgagatatgcttgattgcccaagaaaaggtatggaagatggtgga |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40451837 |
taatgattcattgatgagatatgcttgattgcccaagaaaaggtatggaagatggtgga |
40451895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 131 - 180
Target Start/End: Complemental strand, 40275904 - 40275855
Alignment:
| Q |
131 |
atgattcattgatgagatatgcttgattgcccaagaaaaggtatggaaga |
180 |
Q |
| |
|
|||||||||||||||||||||||| | | ||||| | ||||||||||||| |
|
|
| T |
40275904 |
atgattcattgatgagatatgctttactccccaaaacaaggtatggaaga |
40275855 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 600 times since January 2019
Visitors: 6718