View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0926_high_8 (Length: 422)
Name: NF0926_high_8
Description: NF0926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0926_high_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 321; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 30 - 412
Target Start/End: Complemental strand, 14787928 - 14787546
Alignment:
Q |
30 |
cccgaaacttcactcatcctcttcaaaaacactcttccattttccaaaactgctttcttgtggaacacgcttattcgtgcttattccattgctggnnnnn |
129 |
Q |
|
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
14787928 |
cccgaaacttcactcatcctcttccaaaacactcttccattttccaaaactgctttcttgtggaacacgcttattcgtgcttattccattgctggttttt |
14787829 |
T |
 |
Q |
130 |
nngatgggttttgtgtttacaacaccatggttcgttctggtgttaaacctgatgatcatacttacccttttgttttaaaggcttgttctgattatttgaa |
229 |
Q |
|
|
||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
T |
14787828 |
ttgatgggtttggtgtttataacaccatggttcgttctggtgttaaacctgatgatcatacttacccttttgttttaaaggcttgttctgattatttaaa |
14787729 |
T |
 |
Q |
230 |
gtttgataagggtagggaggttcatggtgttgtgtttaaggttggttttgataaggatgtttttgttggaaatacgcttttgatgttttatggtaattgt |
329 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
14787728 |
gtttgataagggtagggaggttcatggtgttgtgtttaaggttggttttgataaggatgtttttgttggaaatacgcttttgatgttttatggtaattgt |
14787629 |
T |
 |
Q |
330 |
ggnnnnnnngttgatgcgatgaacgtgtttgatgaaatgtttgagagggataaggtgtcgtggaatactgttattggtctgtg |
412 |
Q |
|
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
14787628 |
ggtttttttgttgatgcgatgaacgtgtttgatgaaatgtttgagagggataaggtgtcgtggaatactgttattggtttgtg |
14787546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University