View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0926_high_9 (Length: 410)
Name: NF0926_high_9
Description: NF0926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0926_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 229; Significance: 1e-126; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 141 - 399
Target Start/End: Original strand, 37879925 - 37880176
Alignment:
| Q |
141 |
ggtgcgtggcagatccggatttgttgagagaacaacaaccttcgacgacgccatgcctagtttataggagagtttgttttgtttgttcagcttcggcttc |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37879925 |
ggtgcgtggcagatccggatttgttgagagaacaacaaccttcgatgacgccatgcctagtttataggagagtttgttttgtttgttcagcttcggcttc |
37880024 |
T |
 |
| Q |
241 |
ggcttcaaccctaagaaaagattcagaagcaatagcacaacaatgaaacaatagctatggcctttacttgagtttggatttttaagaattaagattaata |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
37880025 |
ggcttcaaccctaagaaaagattcagaagcaatagcacaacaatgaaacaatagctatggcctttacttgagtttggattt-------ttaagattaata |
37880117 |
T |
 |
| Q |
341 |
atcacatgcatgcaaatcctttatatagctaccctttcttctcttccacgtccacctat |
399 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37880118 |
atcacatgcatgcaaatcctttatatagctaccctttcttctcttccacgtccacctat |
37880176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 30 - 71
Target Start/End: Original strand, 37879823 - 37879864
Alignment:
| Q |
30 |
ggaaaatgttcttgagaatttcgtccatggtggtggtagatc |
71 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37879823 |
ggaaaatgttcttgagaatttcgtccatggtggtggtagatc |
37879864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University