View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0926_low_13 (Length: 431)
Name: NF0926_low_13
Description: NF0926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0926_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 152; Significance: 2e-80; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 92 - 316
Target Start/End: Original strand, 45666012 - 45666240
Alignment:
| Q |
92 |
agttataccctttaaatatgatatggtggtgatttgatagaaatagatagataaagaaaagnnnnnnncaatattgaaaagtttggaagattccaaacgt |
191 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
45666012 |
agttatactctttaaatatgatatggtggtgatttgatagaaatagatagataaagaaaagaaaaaaacaatattgaaaagtttggaagattccaaacgt |
45666111 |
T |
 |
| Q |
192 |
gccgtgataataataataaaacttgaaagaagcccgcccggtgccacnnnnnnnctttgccttatatat-----ctttgtacctctttccttaatcacct |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
45666112 |
gccgtgataataataataaaacttgaaagaagcccgcccggtgccactttttttctttgccttatatatctttactttgtacctc-ttccttaatcacct |
45666210 |
T |
 |
| Q |
287 |
cctaaatttcctttgttcacgttaatatag |
316 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |
|
|
| T |
45666211 |
cctaaatttcctttgttcacattaatatag |
45666240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 420
Target Start/End: Original strand, 45666256 - 45666294
Alignment:
| Q |
382 |
attgtcatcgccaatggctaaacatttctggcttttcat |
420 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
45666256 |
attgtcatcgccaatggctaaacttttctggcttttcat |
45666294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University