View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0926_low_17 (Length: 382)
Name: NF0926_low_17
Description: NF0926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0926_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 8e-77; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 8e-77
Query Start/End: Original strand, 68 - 213
Target Start/End: Original strand, 56311749 - 56311894
Alignment:
Q |
68 |
tgttgttgttagttagttagagagagtggatggcaatagcagcagcaacatcatcacctaacatgagcagcatgagcttgagtcacgaagatggaacttc |
167 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
56311749 |
tgttgttgttagttagttagagagagtggatggcaatagcagcagcaacatcatcacctaacatgagcagcatgagcttgagtcacgaagatggaacttc |
56311848 |
T |
 |
Q |
168 |
taacgataatattaacaaaggagctacagctacagttacagtagta |
213 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
56311849 |
taacgataatattaacaaaggagctacagctacagttacagtagta |
56311894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 235 - 361
Target Start/End: Original strand, 56311922 - 56312048
Alignment:
Q |
235 |
cacgagcatgacgtggttatgccagggtttcgtttccatccaactgaagaagaacttgtagagttctaccttcgccgtaaggtcgagggaaaacgtttca |
334 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
56311922 |
cacgagcatgacgtggttatgccagggtttcgtttccatccaactgaagaagaacttgtagagttctaccttcgccgtaaggtcgagggaaaacgtttca |
56312021 |
T |
 |
Q |
335 |
acgttgagcttattacttttctcgatc |
361 |
Q |
|
|
||||||||||||||||||||||||||| |
|
|
T |
56312022 |
acgttgagcttattacttttctcgatc |
56312048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 293
Target Start/End: Original strand, 8449724 - 8449761
Alignment:
Q |
256 |
ccagggtttcgtttccatccaactgaagaagaacttgt |
293 |
Q |
|
|
||||||||||||||||| |||||||| ||||||||||| |
|
|
T |
8449724 |
ccagggtttcgtttccacccaactgatgaagaacttgt |
8449761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University