View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0926_low_20 (Length: 344)
Name: NF0926_low_20
Description: NF0926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0926_low_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 169 - 206
Target Start/End: Complemental strand, 19852541 - 19852504
Alignment:
Q |
169 |
atgttgaattttgctgaatgtagtaattttctcataca |
206 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |
|
|
T |
19852541 |
atgttgaattttgctgaatgtagtaattttctcataca |
19852504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1441 times since January 2019
Visitors: 6712