View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0926_low_22 (Length: 343)

Name: NF0926_low_22
Description: NF0926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0926_low_22
NF0926_low_22
[»] chr3 (1 HSPs)
chr3 (168-205)||(19852504-19852541)


Alignment Details
Target: chr3 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 168 - 205
Target Start/End: Complemental strand, 19852541 - 19852504
Alignment:
168 atgttgaattttgctgaatgtagtaattttctcataca 205  Q
    ||||||||||||||||||||||||||||||||||||||    
19852541 atgttgaattttgctgaatgtagtaattttctcataca 19852504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University