View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0926_low_26 (Length: 290)
Name: NF0926_low_26
Description: NF0926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0926_low_26 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 56 - 231
Target Start/End: Original strand, 33897709 - 33897884
Alignment:
| Q |
56 |
gtgggttgtgtcttgtatatgctatcattgggtttcaagtgtgaaaatttgatggagaattgtacaagagtggacatggggaatattgaataagggtgaa |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33897709 |
gtgggttgtgtcttgtatatgctatcattgggtttcaagtgtgaaaatttgatggagaattgtacaagagtggacatggggaatattgaataagggtgaa |
33897808 |
T |
|
| Q |
156 |
gtaaaatcttagtgtacttatggagttagaaaaggtttagacatgtcgaatggaacattgcagatgatgatgatgt |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
33897809 |
gtaaaatcttagtgtacttatggagttagaaaaggtttagacatgtcgaatggaacattgtagatgatgatgatgt |
33897884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 747 times since January 2019
Visitors: 6696