View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0926_low_27 (Length: 289)
Name: NF0926_low_27
Description: NF0926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0926_low_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 105; Significance: 2e-52; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 1 - 148
Target Start/End: Complemental strand, 327986 - 327840
Alignment:
| Q |
1 |
aatagttaattacacaattaatcatcagacattgatgaaagnnnnnnnnntactaacaataatttctttaaaaaataaattctaaattgtggtattctaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
327986 |
aatagttaattacacaattaatcatcagacattgatgaaagaaaaaaaaatactaacaataatttctttaaaaaa-aaattctaaattgtggtattctaa |
327888 |
T |
|
| Q |
101 |
ccgcaattgtgaccgcgatataaaagttttagagattcgtacaacttc |
148 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
327887 |
ccgcaattgtgacagcaatataaaagttttagagattcgtacaacttc |
327840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1142 times since January 2019
Visitors: 6710