View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0926_low_29 (Length: 267)

Name: NF0926_low_29
Description: NF0926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0926_low_29
NF0926_low_29
[»] chr7 (1 HSPs)
chr7 (116-159)||(33562331-33562374)


Alignment Details
Target: chr7 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 116 - 159
Target Start/End: Complemental strand, 33562374 - 33562331
Alignment:
116 ttgttacctttgagggtgataggagaagattgatcattgttggc 159  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
33562374 ttgttacctttgagggtgataggagaagattgatcattgttggc 33562331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University