View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0926_low_33 (Length: 251)
Name: NF0926_low_33
Description: NF0926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0926_low_33 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 156; Significance: 5e-83; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 12 - 179
Target Start/End: Complemental strand, 2836908 - 2836741
Alignment:
Q |
12 |
agagaaaaacgaaaactgagaaaaataaacaatactagtactcatgaaaagtgaaaacagaggagagagataaggatttggaagaaaaaggtaacaaaaa |
111 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2836908 |
agagaaaaacgaaaactgagaaaaataaacaatactagtactcatgaaaagtgaaaacagaggagagagataaggatttggaagaaaaaggtaacaaaaa |
2836809 |
T |
 |
Q |
112 |
ttgaacaaatatccgatgattcttgcacatcaggagagaatgagttcttttatgtgaaattcttttaa |
179 |
Q |
|
|
||||||| |||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
T |
2836808 |
ttgaacatatatccgatgattcttgcacatcaagagagaatgagttcttttaagtgaaattcttttaa |
2836741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 175 - 251
Target Start/End: Complemental strand, 2836654 - 2836578
Alignment:
Q |
175 |
tttaaaaatgaaaaggccacaatttcacacaagaatccctcaagataccgaacccccattttaagtcttttagcaat |
251 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
2836654 |
tttaaaaatgaaaaggccacaatttcacacaagaatccctcaagataccgaatccccattttaagtcttttagcaat |
2836578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 640 times since January 2019
Visitors: 6696