View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0926_low_37 (Length: 238)
Name: NF0926_low_37
Description: NF0926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0926_low_37 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 18 - 213
Target Start/End: Complemental strand, 43791092 - 43790897
Alignment:
| Q |
18 |
cttccaaagtactaatatttccaatttcacgaggcagtgatccaacaaaggtgttgttgttgagtacaagatctgtgaggttctgaagcttgtctatggt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43791092 |
cttccaaagtactaatatttccaatttcacgaggcagtgatccaacaaaggtgttgttgttgagtacaagatctgtgaggttctgaagcttgtctatggt |
43790993 |
T |
 |
| Q |
118 |
agatggaatttcactttcaaagctatttccagaaagatccaactgttgtattgaggaacagctgagtaactccaatggaaattttccagatagaat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43790992 |
agatggaatttcactttcaaagctatttccagaaagatccaactgttgtattgaggaacagctgagtaactccaatggaaattttccagatagaat |
43790897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University