View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0926_low_40 (Length: 212)
Name: NF0926_low_40
Description: NF0926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0926_low_40 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 82; Significance: 7e-39; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 1 - 86
Target Start/End: Original strand, 38770898 - 38770983
Alignment:
| Q |
1 |
cactgctgccaaccaacatcagaagccttggatatatcttctatgctagatgttgcttccactactttgttatccacaggttctgc |
86 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
38770898 |
cactgctgccaaccaacatcagaagccttggatatatcttctatgctagatgttgcttccactactttgttatccacagattctgc |
38770983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 554 times since January 2019
Visitors: 6717