View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0926_low_44 (Length: 202)
Name: NF0926_low_44
Description: NF0926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0926_low_44 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 160; Significance: 2e-85; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 19 - 178
Target Start/End: Original strand, 40451737 - 40451896
Alignment:
| Q |
19 |
atgaaagaatatggtgaagaatgttatcgggtaagtcactaatatttttctccattttgagtgatgatgattcattgatgagatttttcatcttttcgtg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40451737 |
atgaaagaatatggtgaagaatgttatcgggtaagtcactaatatttttctccattttgagtgatgatgattcattgatgagatttttcatcttttcgtg |
40451836 |
T |
 |
| Q |
119 |
taatgattcattgatgagatatgcttgattgcccaagaaaaggtatggaagatggtggac |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40451837 |
taatgattcattgatgagatatgcttgattgcccaagaaaaggtatggaagatggtggac |
40451896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 121 - 170
Target Start/End: Complemental strand, 40275904 - 40275855
Alignment:
| Q |
121 |
atgattcattgatgagatatgcttgattgcccaagaaaaggtatggaaga |
170 |
Q |
| |
|
|||||||||||||||||||||||| | | ||||| | ||||||||||||| |
|
|
| T |
40275904 |
atgattcattgatgagatatgctttactccccaaaacaaggtatggaaga |
40275855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University