View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0926_low_6 (Length: 611)
Name: NF0926_low_6
Description: NF0926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0926_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 485; Significance: 0; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 485; E-Value: 0
Query Start/End: Original strand, 93 - 593
Target Start/End: Original strand, 1016895 - 1017395
Alignment:
Q |
93 |
ctttcatgacacatcagctccggcagccctggcaccgatttcacggagtccaagttttcggagcattttctttggggagaattgggcggagctgccgctg |
192 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1016895 |
ctttcatgacacatcagctccggcagccctggcaccgatttcacggagtccaagttttcggagcattttctttggggagaattgggcggagctgccgctg |
1016994 |
T |
 |
Q |
193 |
aaggaggatgataccgaagacatggtcatctatggagctttgcgcgaagctgctgccaccacgggctggttcccggctagtaacaaagtggtgaacaatg |
292 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
1016995 |
aaggaggatgataccgaagacatggtcatctatggagctttgcgcgaagctgctgccaccacgggctggttcccgcctagtaacaaagtggtgaacaatg |
1017094 |
T |
 |
Q |
293 |
ttgatatggcggtgaaaatagaagatcaaggtcaaagcagtggaacttcattggtgagtgttgctcacgtgcaacaagcgccaacgactagtaaaaggtt |
392 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
1017095 |
ttgatatggcggtgaaaatagaagatcaaggtcaaagcagtggaacttcattggcgagtgttgctcacgtgcaacaagtgccaacgactagtaaaaggtt |
1017194 |
T |
 |
Q |
393 |
agggtaccgtggagttaggagaaggccttggggaaagtatgcggctgagataagggatcctaagagaaatggcgcgagggtgtggcttgggacttatgaa |
492 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1017195 |
agggtaccgtggagttaggagaaggccttggggaaagtatgcggctgagataagggatcctaagagaaatggcgcgagggtgtggcttgggacttatgaa |
1017294 |
T |
 |
Q |
493 |
acggctgagaatgcagcgttggcttatgatcgagctgcgtttaaaatacgtggctcaaaagctaagctaaattttcctcatttgatcgactcagattaca |
592 |
Q |
|
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1017295 |
acggctgagaatgcagctttggcttatgatcgagctgcgtttaaaatacgtggctcaaaagctaagctaaattttcctcatttgatcgactcagattaca |
1017394 |
T |
 |
Q |
593 |
c |
593 |
Q |
|
|
| |
|
|
T |
1017395 |
c |
1017395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 415 - 584
Target Start/End: Complemental strand, 1002737 - 1002568
Alignment:
Q |
415 |
aggccttggggaaagtatgcggctgagataagggatcctaagagaaatggcgcgagggtgtggcttgggacttatgaaacggctgagaatgcagcgttgg |
514 |
Q |
|
|
|||||||||||||||| ||| |||||||| || ||||| || | ||| ||||||||||||||||||||||||||||| ||||||| |||| || |||| |
|
|
T |
1002737 |
aggccttggggaaagtttgcagctgagattagagatccaaataaaaacggcgcgagggtgtggcttgggacttatgagtcggctgaagatgctgctttgg |
1002638 |
T |
 |
Q |
515 |
cttatgatcgagctgcgtttaaaatacgtggctcaaaagctaagctaaattttcctcatttgatcgactc |
584 |
Q |
|
|
||||||| ||||| || ||||| || || ||||| || |||||| | || || ||||||||||| ||||| |
|
|
T |
1002637 |
cttatgaccgagccgcttttaagatgcgcggctcgaaggctaagttgaacttccctcatttgattgactc |
1002568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 395 - 443
Target Start/End: Original strand, 15403561 - 15403609
Alignment:
Q |
395 |
ggtaccgtggagttaggagaaggccttggggaaagtatgcggctgagat |
443 |
Q |
|
|
|||||||||| || ||||||||||| |||||||| |||| ||||||||| |
|
|
T |
15403561 |
ggtaccgtggtgtaaggagaaggccatggggaaaatatggggctgagat |
15403609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 869 times since January 2019
Visitors: 6705