View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0927_high_11 (Length: 315)
Name: NF0927_high_11
Description: NF0927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0927_high_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 6 - 298
Target Start/End: Original strand, 29404860 - 29405152
Alignment:
Q |
6 |
tggacatcatcaattcccattccaacatcagacatccctatccaaaatccaaacagcagaagcttttcacaattcggtcgtcgcaattcagttcgagtcc |
105 |
Q |
|
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
29404860 |
tggacatcatcaattcccattccaacatccgacatccctatccaaaatccaaacagcagaagcttttcacaattcggtcgtcgcaactcagttcgagtcc |
29404959 |
T |
 |
Q |
106 |
aaactcattacgactcagacatgtcaacacaccaagtagatgacctcgatccatcagatgaatccaatgctccagctagcaggccaaaattcactcgtgg |
205 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29404960 |
aaactcattacgactcagacatgtcaacacaccaagtagatgagctcgatccatcagatgaatccaatgctccagctagcaggccaaaattcactcgtgg |
29405059 |
T |
 |
Q |
206 |
gagctcaactcggttcacggcagattcccctgagaattctggcggaggaaatctacgaccacaactatcacgcaagaattccaccaacgtgtc |
298 |
Q |
|
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29405060 |
gagctcaactcggttcacggcagattcctctgagaattctggcggaggaaatctacgaccacaactatcacgcaagaattccaccaacgtgtc |
29405152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 49; Significance: 5e-19; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 6 - 133
Target Start/End: Complemental strand, 19911952 - 19911822
Alignment:
Q |
6 |
tggacatcatcaattcccattccaacatcagacatccctatccaaaatccaaacagcagaagcttttcacaattcggtcgtcgcaattcagttcgagtcc |
105 |
Q |
|
|
||||||||| | |||| |||||||| ||||| || |||||||||||||| || || ||||| ||||| ||||||||||||||||| ||||| ||| ||| |
|
|
T |
19911952 |
tggacatcaacgattcatattccaacttcagatattcctatccaaaatcctaatagtagaagtttttctcaattcggtcgtcgcaactcagtccgaatcc |
19911853 |
T |
 |
Q |
106 |
aaactcattac---gactcagacatgtcaac |
133 |
Q |
|
|
||||||| || ||||||||||||||||| |
|
|
T |
19911852 |
aaactcaccacgatgactcagacatgtcaac |
19911822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 233 times since January 2019
Visitors: 6714