View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0927_high_17 (Length: 260)
Name: NF0927_high_17
Description: NF0927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0927_high_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 99; Significance: 6e-49; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 133 - 239
Target Start/End: Complemental strand, 11075050 - 11074944
Alignment:
| Q |
133 |
tttatttatgtcatcttcttcatcttcaaatttatcaaccttcttcatctacattttgacttcaaaagcaaaaagaaatatccatcatatttatctcatc |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
11075050 |
tttatttatgtcatcttcttcatcttcaaatttatcaaccttcttcatctgcattttgacttcaaaagcaaaaagaaatatccaccatatttatctcatc |
11074951 |
T |
 |
| Q |
233 |
atcttca |
239 |
Q |
| |
|
||||||| |
|
|
| T |
11074950 |
atcttca |
11074944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 149 - 239
Target Start/End: Complemental strand, 11055744 - 11055653
Alignment:
| Q |
149 |
tcttcatcttcaaatttatcaaccttcttcatctacatttt-gacttcaaaagcaaaaagaaatatccatcatatttatctcatcatcttca |
239 |
Q |
| |
|
||||||||||||||| ||||||| |||||| ||| ||| || |||||| |||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11055744 |
tcttcatcttcaaatgtatcaactttcttcgtctgcatcttcgacttctaaagaaaaaagaaatatccatcatatttatctcatcatcttca |
11055653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University