View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0927_high_24 (Length: 251)
Name: NF0927_high_24
Description: NF0927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0927_high_24 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 10 - 251
Target Start/End: Complemental strand, 31219695 - 31219447
Alignment:
| Q |
10 |
gcagagacaaaattgaaatctaaacttgtataccacttatatacatgtgtacgaagagtgctatacttagatcctttgaatcacaaaacgtttcaatgtc |
109 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
31219695 |
gcagagacaaaattgaaatataaacttgtataccacttatatacatatgtacgaagagtgctatacttagattctttgaatcacaaaacgtttcaatgtc |
31219596 |
T |
|
| Q |
110 |
catgaatcacaatagcgtgagttctaagactaagcct-------acaaaatgttgaaaacgtgaattgctttatttacctttcttccaagaagaggaaaa |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
31219595 |
catgaatcacaatagcgtgagttctaagactaagcctaaacatgacaaaatgttgaaaacgtgaattgctttatttacctttcttccaagaagagtaaaa |
31219496 |
T |
|
| Q |
203 |
ctttcaatgacattataaaagtgatgggatgaaacatgaattgatgagt |
251 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
31219495 |
ctttcaacgacattataaaagtgatgggatgaaacatggattgatgagt |
31219447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 556 times since January 2019
Visitors: 6704