View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0927_low_19 (Length: 331)
Name: NF0927_low_19
Description: NF0927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0927_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 78; Significance: 3e-36; HSPs: 6)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 14 - 95
Target Start/End: Complemental strand, 11136007 - 11135926
Alignment:
| Q |
14 |
agattcaggtagcacaattccagcaactccacttcctgtttcatcaaatcttcaccattaagtatctcaaccatactgtact |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
11136007 |
agattcaggtagcacaattccagcaactccacttcctgtttcatcaaatcttcaccattaagtatctcaacaatactgtact |
11135926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 15 - 106
Target Start/End: Original strand, 23259264 - 23259358
Alignment:
| Q |
15 |
gattcaggtagcacaattccagcaactccacttcctgtttcatcaaatcttcaccattaagtatctcaacca---tactgtactatcaatattgg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| | |||| ||||||||||||||| |
|
|
| T |
23259264 |
gattcaggtagcacaattccagcaactccacttcctgtttcatcaaattttcaccattaagtatctcaacaattctactatactatcaatattgg |
23259358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 15 - 104
Target Start/End: Original strand, 23277142 - 23277234
Alignment:
| Q |
15 |
gattcaggtagcacaattccagcaactccacttcctgtttcatcaaatcttcaccattaagtatctcaacca---tactgtactatcaatatt |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| || |||||| |||| ||||||||||||||| | |||| ||||||||||||| |
|
|
| T |
23277142 |
gattcaggtagcacaattccagcaactccacttcctgttacaacaaatcatcactattaagtatctcaacaattctactatactatcaatatt |
23277234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 15 - 106
Target Start/End: Original strand, 27543667 - 27543761
Alignment:
| Q |
15 |
gattcaggtagcacaattccagcaactccacttcctgtttcatcaaatcttcaccattaagtatctcaacca---tactgtactatcaatattgg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||| |||||||| |||||||| |||||||| | |||| ||||||||||||||| |
|
|
| T |
27543667 |
gattcaggtagcacaattccagcaactccacttcctgtatcaacaaatctttgccattaagaatctcaacaattctactatactatcaatattgg |
27543761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 201 - 269
Target Start/End: Complemental strand, 11135820 - 11135753
Alignment:
| Q |
201 |
aaccataccagaaaaacaaaatcaaacaacannnnnnnaaaataatcagttttagaaaattcaatctgt |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
11135820 |
aaccataccagaaaaacaaaatcaaacaacatttttt-aaaataatcagttttagaaaattcaatctgt |
11135753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 266 - 302
Target Start/End: Complemental strand, 11135299 - 11135263
Alignment:
| Q |
266 |
ctgtcagacacatatgcaatcgtgtccgtgtgtatgc |
302 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |
|
|
| T |
11135299 |
ctgtcagacacatatgcaatcgtgtcagtgtgtatgc |
11135263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 629 times since January 2019
Visitors: 6705