View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0927_low_20 (Length: 324)
Name: NF0927_low_20
Description: NF0927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0927_low_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 97; Significance: 1e-47; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 85 - 233
Target Start/End: Original strand, 27693472 - 27693622
Alignment:
| Q |
85 |
gtgtcttttaactaaatgtgtatctagtgcgnnnnnnnnn--acttacgcaagagaatgaagagaaatagagcgcgcactgctgtatcgtatatcatgct |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||| || ||||||||||||||||||||| |
|
|
| T |
27693472 |
gtgtcttttaactaaatgtgtatctagtgcgtttttttttttacttacgcaagagaatgaagaaaaatagagcgcccattgctgtatcgtatatcatgct |
27693571 |
T |
|
| Q |
183 |
gcggtatgacaattgttcctcttcccggtcacggtctctgtcttgctgatg |
233 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27693572 |
ggggtatgacaattgttcctcttcccggtcacggtctctgtcttgctgatg |
27693622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1188 times since January 2019
Visitors: 6711