View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0927_low_24 (Length: 283)

Name: NF0927_low_24
Description: NF0927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0927_low_24
NF0927_low_24
[»] chr3 (2 HSPs)
chr3 (98-200)||(46898168-46898270)
chr3 (101-157)||(32715228-32715284)


Alignment Details
Target: chr3 (Bit Score: 95; Significance: 2e-46; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 98 - 200
Target Start/End: Original strand, 46898168 - 46898270
Alignment:
98 catggtacacaactctttccacttgatacctcttcttctttgctctcatactgacttgagcgtctcaacatccatatcggcagacactgttcatgctcgg 197  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
46898168 catggtacacaactctttccacttgatacctcttcctctttgctctcatactgacttgagcgtgtcaacatccatatcggcagacactgttcatgctcgg 46898267  T
198 ccc 200  Q
    |||    
46898268 ccc 46898270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 101 - 157
Target Start/End: Original strand, 32715228 - 32715284
Alignment:
101 ggtacacaactctttccacttgatacctcttcttctttgctctcatactgacttgag 157  Q
    ||||||||| || |||||||||||||||||   |||||||||||||||| |||||||    
32715228 ggtacacaattccttccacttgatacctctcactctttgctctcatactaacttgag 32715284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 649 times since January 2019
Visitors: 6696