View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0927_low_25 (Length: 283)
Name: NF0927_low_25
Description: NF0927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0927_low_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 38 - 244
Target Start/End: Complemental strand, 39998122 - 39997916
Alignment:
| Q |
38 |
gagggccctcctaagcaaaatttactttaagcaatggccttcaaaagattcgatttccactgtccaagtgtctctcttggattcctggaaattggtcatt |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39998122 |
gagggccctcctaagcaaaatttactttaagcaatggccttcaaaagattcgatttccactgtccaagtgtctctcttggattcctggaaattggtcatt |
39998023 |
T |
 |
| Q |
138 |
ctctttagtacatgatactcctttctaaagtaattgatttgctatgtgcattattaagatgacactagaaaaatggtagtatataagatgttgttaaatt |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39998022 |
ctctttagtacatgatactcctttctaaagtaattgatttgctatgtgcattattaagatgacactagaaaaatggtagtatataagatgttgttaaatt |
39997923 |
T |
 |
| Q |
238 |
catctca |
244 |
Q |
| |
|
||||||| |
|
|
| T |
39997922 |
catctca |
39997916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University