View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0927_low_35 (Length: 258)
Name: NF0927_low_35
Description: NF0927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0927_low_35 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 30 - 242
Target Start/End: Original strand, 42827155 - 42827374
Alignment:
| Q |
30 |
gaaaccacaacctcgtccgaacagtgctttgtcgctgctttgtaaagagaatttggaaccatcttcgccttcgaactccattcagaattctttagaaata |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42827155 |
gaaaccacaacctcgtccgaacagtgctttgtcgctgctttgtaaagagaatttggaaccatcttcgccttcgaactccattcagaattctttagaaata |
42827254 |
T |
 |
| Q |
130 |
tttggcggtgaaaagtaataacctagcaccgttaattctaaagaaa--atatatatattaatgacttaaatatgtaaatggt-----taagttcgcgcat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
42827255 |
tttggcggtgaaaagtaataacctagcaccgttaattctaaagaaaatatatatatattaatgacttaaatatgtaaacggttcttgtaagttcgcgcat |
42827354 |
T |
 |
| Q |
223 |
ttttggtttggtgcctgcaa |
242 |
Q |
| |
|
|||||||||||| ||||||| |
|
|
| T |
42827355 |
ttttggtttggtccctgcaa |
42827374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University