View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0927_low_42 (Length: 251)
Name: NF0927_low_42
Description: NF0927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0927_low_42 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 27 - 237
Target Start/End: Original strand, 45295050 - 45295260
Alignment:
| Q |
27 |
agctgcacaggaagcagcagagagatcattgaagctagctgatagtagaggagttgaactgcgtcggtggatagaggaactaaccagacaactagaggaa |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45295050 |
agctgcacaggaagcagcagagagatcattgaagctagctgatagtagaggagttgaactgcgtcggtggatagaggaactaaccagacaactagaggaa |
45295149 |
T |
|
| Q |
127 |
tcagagaaacgtgaatgtaatagtcataaagtgagtcgacgtatatgttggccatggcaagttttcagattgagttctagcaatattgctacctctagaa |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45295150 |
tcagagaaacgtgaatgtaatagtcataaagtgagtcgacgaatatgttggccatggcaagttttcagattgagttctagcaatattgctacctctagaa |
45295249 |
T |
|
| Q |
227 |
ttggaaatgcc |
237 |
Q |
| |
|
||||||||||| |
|
|
| T |
45295250 |
ttggaaatgcc |
45295260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1303 times since January 2019
Visitors: 6712