View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0927_low_46 (Length: 251)
Name: NF0927_low_46
Description: NF0927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0927_low_46 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 9 - 251
Target Start/End: Original strand, 31438351 - 31438593
Alignment:
| Q |
9 |
agcagagagacaggcttcaagaatgagagtggaatacctaaaatcagtcttaagacaagaagttggtttctttgacacacaaactgctggttcttcaaca |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31438351 |
agcagagagacaggcttcaagaatgagagtggaatacctaaaatcagtcttaagacaagaagttggtttctttgacacacaaactgctggttcttcaaca |
31438450 |
T |
|
| Q |
109 |
acataccaagttgtctcactcatctcctctgatgcaaatacagtccaatctgccttgtgtgagaaggtttgtcacaaacttctcaaaatccaaaaaatca |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31438451 |
acataccaagttgtctcactcatctcctctgatgcaaatacagtccaatctgccttgtgtgagaaggtttgtcacaaacttctcaaaatccaaaaaatca |
31438550 |
T |
|
| Q |
209 |
tgtacatttgaacacaatcgggatgattctaacatatatcacg |
251 |
Q |
| |
|
||||| |||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
31438551 |
tgtacgtttgaacacaatcgggatgattataatatatatcacg |
31438593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 40 - 85
Target Start/End: Original strand, 39154136 - 39154181
Alignment:
| Q |
40 |
gaatacctaaaatcagtcttaagacaagaagttggtttctttgaca |
85 |
Q |
| |
|
||||| ||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
39154136 |
gaatatctaaaatcaatcctaagacaagaagttggtttctttgaca |
39154181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 158 times since January 2019
Visitors: 6713