View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0927_low_52 (Length: 201)
Name: NF0927_low_52
Description: NF0927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0927_low_52 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 134; Significance: 6e-70; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 1 - 146
Target Start/End: Complemental strand, 23423154 - 23423009
Alignment:
| Q |
1 |
gttgaattttttagcgatgtcgattacatcgcttgagaaaagatcaaaaaccaaaccaacaaagtttgtttttgaacaagttaccattttgttaacttct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23423154 |
gttgaattttttagcgatgtcgattacatcgcttgagaaaagatcaaaaaccaaacaaacaaagtttgtttttgaacaagttaccattttgttaacttct |
23423055 |
T |
 |
| Q |
101 |
tgatgcaaatagggcatagagtgtttaactgtgagtttcatctgtg |
146 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
23423054 |
tgatgcaaatagggtatagagtgtttaactgtgagtttcatttgtg |
23423009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 1 - 146
Target Start/End: Original strand, 549474 - 549619
Alignment:
| Q |
1 |
gttgaattttttagcgatgtcgattacatcgcttgagaaaagatcaaaaaccaaaccaacaaagtttgtttttgaacaagttaccattttgttaacttct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
549474 |
gttgaattttttagcgatgtcgattacatcacttgagaaaagatcaaaaaccaaaccaacaaagtttgtttttgaacaagttacgattttgttaacttct |
549573 |
T |
 |
| Q |
101 |
tgatgcaaatagggcatagagtgtttaactgtgagtttcatctgtg |
146 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
549574 |
tgatgcaaatagggtatagagtgtttaactgtgagtttcatttgtg |
549619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University