View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_high_101 (Length: 352)
Name: NF0928_high_101
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0928_high_101 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 138; Significance: 4e-72; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 73 - 210
Target Start/End: Complemental strand, 35382715 - 35382578
Alignment:
| Q |
73 |
agacttatcccaatgatctaattacaaaggtacaggaaattaaggcatgagccacagggtgtcagtcaaatagtacgaccggattgtgcaacccaagatt |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35382715 |
agacttatcccaatgatctaattacaaaggtacaggaaattaaggcatgagccacagggtgtcagtcaaatagtacgaccggattgtgcaacccaagatt |
35382616 |
T |
 |
| Q |
173 |
aattttgaaaaataagggcacaaataatgggaatggat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35382615 |
aattttgaaaaataagggcacaaataatgggaatggat |
35382578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 113 - 198
Target Start/End: Complemental strand, 35387740 - 35387657
Alignment:
| Q |
113 |
taaggcatgagccacagggtgtcagtcaaatagtacgaccggattgtgcaacccaagattaattttgaaaaataagggcacaaata |
198 |
Q |
| |
|
|||||||||||||||| | | || |||||||||||| |||| |||||||| ||||| |||||||||| |||||||||||||||||| |
|
|
| T |
35387740 |
taaggcatgagccacaag-tatctgtcaaatagtacaaccgaattgtgcagcccaatattaattttg-aaaataagggcacaaata |
35387657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 260 - 298
Target Start/End: Complemental strand, 35382579 - 35382541
Alignment:
| Q |
260 |
atcctcttagtttatgacttatgtgctcaaatgctctat |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35382579 |
atcctcttagtttatgacttatgtgctcaaatgctctat |
35382541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University