View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_high_132 (Length: 319)
Name: NF0928_high_132
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0928_high_132 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 269; Significance: 1e-150; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 14 - 290
Target Start/End: Original strand, 17973159 - 17973435
Alignment:
| Q |
14 |
atataggcgaggactggtcaaaagtagctcatgttcagcttatttaagtagaaagtcagaaagtatgataaggtggttgacaatatggtgccaatgcacc |
113 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
17973159 |
atataggcgaggactggtcaaaagtaactcatgttcagcttatttaagtagaaagtcagaaagtatgataaggtggtcgacaatatggtgccaatgcacc |
17973258 |
T |
|
| Q |
114 |
attgttccgtggatgaatacatttatcaggtagacacttccctgccctgatatatatgtataccattgtatgctaattatcattataatcttctacactc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17973259 |
attgttccgtggatgaatacatttatcaggtagacacttccctgccctgatatatatgtataccattgtatgctaattatcattataatcttctacactc |
17973358 |
T |
|
| Q |
214 |
tgacaattgtaagtaaaaatgcataattatttactgtaaacctcctgcaaatcatgtgatcttatatgtgtcatttc |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17973359 |
tgacaattgtaagtaaaaatgcataattatttactgtaaacctcctgcaaatcatgtgatcttatatgtgtcatttc |
17973435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 16 - 89
Target Start/End: Complemental strand, 17925909 - 17925836
Alignment:
| Q |
16 |
ataggcgaggactggtcaaaagtagctcatgttcagcttatttaagtagaaagtcagaaagtatgataaggtgg |
89 |
Q |
| |
|
|||||||||||||||| |||| |||| |||||||||| |||| || |||||||| ||||||| |||| ||||| |
|
|
| T |
17925909 |
ataggcgaggactggttaaaaatagcccatgttcagcgtattgaaatagaaagtaggaaagtaggatatggtgg |
17925836 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 469 times since January 2019
Visitors: 6717