View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_high_150 (Length: 295)
Name: NF0928_high_150
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0928_high_150 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 208
Target Start/End: Complemental strand, 41062966 - 41062759
Alignment:
| Q |
1 |
taattatcaaaatccttaataacatttgcatgataaaaccaacctatataggagaagagaaatcaaacaacttgcagaaaaaactgagtcatgaaaatta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41062966 |
taattatcaaaatccttaataacatttgcatgataaaaccaacctatccaggagaagagaaatcaaacaacttgcagaaaaaactgagtcatgaaaatta |
41062867 |
T |
|
| Q |
101 |
tgagcttattatttgttgtattcatcctggtggaatttatttcaccaattgtctcaatagaagatcatgcaagggaccttcttgcagccaccgatgagat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41062866 |
tgagcttattatttgttgtattcatcctggtggaatttatttcaccaattgtctcaatagaagatcatgcaagggaccttcttgcagccaccgatgagat |
41062767 |
T |
|
| Q |
201 |
gcaaagag |
208 |
Q |
| |
|
|||||||| |
|
|
| T |
41062766 |
gcaaagag |
41062759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 465 times since January 2019
Visitors: 6717