View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0928_high_150 (Length: 295)

Name: NF0928_high_150
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0928_high_150
NF0928_high_150
[»] chr4 (1 HSPs)
chr4 (1-208)||(41062759-41062966)


Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 208
Target Start/End: Complemental strand, 41062966 - 41062759
Alignment:
1 taattatcaaaatccttaataacatttgcatgataaaaccaacctatataggagaagagaaatcaaacaacttgcagaaaaaactgagtcatgaaaatta 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||    
41062966 taattatcaaaatccttaataacatttgcatgataaaaccaacctatccaggagaagagaaatcaaacaacttgcagaaaaaactgagtcatgaaaatta 41062867  T
101 tgagcttattatttgttgtattcatcctggtggaatttatttcaccaattgtctcaatagaagatcatgcaagggaccttcttgcagccaccgatgagat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41062866 tgagcttattatttgttgtattcatcctggtggaatttatttcaccaattgtctcaatagaagatcatgcaagggaccttcttgcagccaccgatgagat 41062767  T
201 gcaaagag 208  Q
    ||||||||    
41062766 gcaaagag 41062759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 465 times since January 2019
Visitors: 6717