View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_high_158 (Length: 289)
Name: NF0928_high_158
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0928_high_158 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 27 - 274
Target Start/End: Complemental strand, 51005275 - 51005036
Alignment:
Q |
27 |
gtttacctttcctccttgaaatactgggagatataatgtgtggtaaaattcccatgcagattctctaaagaaatcacttaaaaatttcatcttatgtaac |
126 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
51005275 |
gtttaactttcctccttgaaatactgggagatataatgtgtggtaaaattcccatgcagattctctaaagaaatcacttaaaaatttcatcttatgtaac |
51005176 |
T |
 |
Q |
127 |
atcaagacatcaagttagaatcaacacataattttacaaatgaagcatcttctggatggtatttccaactttttcactggttattttaaaatgaatgata |
226 |
Q |
|
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| | |
|
|
T |
51005175 |
atcaag--------ttagaatcaacacataattttacaaatgaagcatcttctggatggtatttccaactctttcactggttattttaaaataaatgaaa |
51005084 |
T |
 |
Q |
227 |
ttattagttctttacacatttaaaatttcttatgacgaagtttttcat |
274 |
Q |
|
|
| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
51005083 |
taattagttctttacacatttaaaatttcttatgacgaagtttttcat |
51005036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 236 times since January 2019
Visitors: 6702