View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_high_169 (Length: 275)
Name: NF0928_high_169
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0928_high_169 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 134 - 275
Target Start/End: Complemental strand, 23625640 - 23625496
Alignment:
| Q |
134 |
gaatgaataaccaatgtagtt---taattgagcttttcttcttgtagttaattgtaaataggggtattttcattggtttgacgttcagcttgtgtttgac |
230 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23625640 |
gaatgaataaccaatgtagttagttaattgaacttttcttcttgtagttaattgtcaacaggggtattttcattggtttgacgttcagcttgtgtttgac |
23625541 |
T |
 |
| Q |
231 |
gtttaacttatactacgtactgtaccttattataccattgaagac |
275 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
23625540 |
gtttaacttatactgcgtactgtaccttattataccattgaagac |
23625496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 55 - 126
Target Start/End: Complemental strand, 23627662 - 23627588
Alignment:
| Q |
55 |
taggtgatttaattcaaagttttgtgcaatgttggtacgaactacata---aagggaagaacgagaacacatgtg |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
23627662 |
taggtgatttaattcaaagttttgtgcaatgttggtacgaactacataaagaagggaagaacgaaaacacatgtg |
23627588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University