View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_high_175 (Length: 263)
Name: NF0928_high_175
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0928_high_175 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 181 - 251
Target Start/End: Original strand, 21907455 - 21907525
Alignment:
Q |
181 |
actaaatatggcttgtgcttaaaaaatgaacaaatataatttgctgagtttactaatgttaggttcccaaa |
251 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||| |||| |
|
|
T |
21907455 |
actaaatatggcttgtgcttaaaaaatgaacaaatataatttgctgagtttgctaacgttaggttcgcaaa |
21907525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 153 - 251
Target Start/End: Original strand, 26556794 - 26556891
Alignment:
Q |
153 |
gaaaattgatagtagtacttaaaatttgactaaatatggcttgtgcttaaaaaatgaacaaatataatttgctgagtttactaatgttaggttcccaaa |
251 |
Q |
|
|
|||||| ||||||||||||||||| |||| |||||| ||||||||||||||||||| |||||||||||| | |||||||||| ||||||||||| |||| |
|
|
T |
26556794 |
gaaaatcgatagtagtacttaaaacttgaataaatacggcttgtgcttaaaaaatg-acaaatataattggttgagtttactgatgttaggttcgcaaa |
26556891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University