View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0928_high_177 (Length: 263)

Name: NF0928_high_177
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0928_high_177
NF0928_high_177
[»] chr3 (1 HSPs)
chr3 (41-238)||(52049469-52049664)


Alignment Details
Target: chr3 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 41 - 238
Target Start/End: Complemental strand, 52049664 - 52049469
Alignment:
41 aaagcttgcgccactcaatattgataaaaggtttattggttaccctgctgctgctttaggagcaaactttaaattagttcaagtaaa-taaataataaaa 139  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||   |||||||||||||||||||||||||||||||| ||||||||||||    
52049664 aaagcttgcgccactcaatattgataaaaggtttattggttaccctgctgct---ttaggagcaaactttaaattagttcaagtaaaataaataataaaa 52049568  T
140 atgaggaaaatctatacatacgtaggtttataatgcttcgtggttcatccggattctacacgtatgccatttacgatcatttgaaggaatggcctgcct 238  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52049567 atgaggaaaatctatacatacgtaggtttataatgcttcgtggttcatccggattctacacgtatgccatttacgatcatttgaaggaatggcctgcct 52049469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 588 times since January 2019
Visitors: 6718