View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_high_182 (Length: 258)
Name: NF0928_high_182
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0928_high_182 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 30 - 178
Target Start/End: Complemental strand, 6105919 - 6105771
Alignment:
Q |
30 |
gatacatgttaaagaggctactgatgaattgacttcttgtgatgaacatgaaggtagttcaaagctgcatggtcctgaaaggttattgtcaaccagaaag |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6105919 |
gatacatgttaaagaggctactgatgaattgacttcttgtgatgaacatgaaggtagttcaaagctgcatggtcctgaaaggttattgtcaaccagaaag |
6105820 |
T |
 |
Q |
130 |
gtgaagatattatctcaannnnnnnnggacttaattttgttatttcttt |
178 |
Q |
|
|
|||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
6105819 |
gtgaagatattatctcaatttttttttgacttaattttgttatttcttt |
6105771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University