View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_high_197 (Length: 253)
Name: NF0928_high_197
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0928_high_197 |
 |  |
|
[»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 13 - 253
Target Start/End: Complemental strand, 5125049 - 5124815
Alignment:
Q |
13 |
cagaagtgtatggcttgtagcaaaacagtttatcttgttgataagttaactgctgataatagaattttccacaaagcttgtttcagatgtcaccactgca |
112 |
Q |
|
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5125049 |
cagaagtgtatggcttgtaacaaaacagtttatcttgttgataagttaactgctgataatagaattttccacaaagcttgtttcagatgtcaccactgca |
5124950 |
T |
 |
Q |
113 |
aaggaaccctcaaggtctatgtctctctcataaataacctcttagacatttatttttggtcnnnnnnnnnnnnnnnnngtctagtttagccttttactat |
212 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
T |
5124949 |
aaggaaccctcaaggtctatgtctctctcataaataacctcttagacatttatttttggtc------atatatatatagtctagtttagccttctactat |
5124856 |
T |
 |
Q |
213 |
tggatctgttggaatcattatcatcaattttagtacatgtt |
253 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5124855 |
tggatctgttggaatcattatcatcaattttagtacatgtt |
5124815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University