View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_high_203 (Length: 251)
Name: NF0928_high_203
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0928_high_203 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 1e-89; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 42 - 216
Target Start/End: Complemental strand, 36314297 - 36314123
Alignment:
| Q |
42 |
taaaatatttcataatttgtttggaaccctagccgccgttttcttctttaactatcctctcttttactattgttaacactttcatccgcaagttggtggt |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
36314297 |
taaaatatttcataatttgtttggaaccctagccgccgttttcttctttaactatcctctcttttactattgttaacactttcgtccgcaagttggtggt |
36314198 |
T |
 |
| Q |
142 |
gttacgggtgacttccaacaatccttttaaaagtttattgataatttcactttccaaacgtttactttcacggta |
216 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36314197 |
gttacgcgtgacttccaacaatccttttaaaagtttattgataatttcactttccaaacgtttactttcacggta |
36314123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 36314745 - 36314696
Alignment:
| Q |
1 |
tcggattgaagggaccactcgatccgatgaacgtcccctattaaaatatt |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36314745 |
tcggattgaagggaccactcgatccgatgaacgtcccctattaaaatatt |
36314696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 161 - 216
Target Start/End: Complemental strand, 36334246 - 36334191
Alignment:
| Q |
161 |
aatccttttaaaagtttattgataatttcactttccaaacgtttactttcacggta |
216 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
36334246 |
aatccttttcaaagtttattgatattttcactttccaaacgtttactttcacggta |
36334191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 197
Target Start/End: Complemental strand, 36328342 - 36328302
Alignment:
| Q |
157 |
caacaatccttttaaaagtttattgataatttcactttcca |
197 |
Q |
| |
|
||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
36328342 |
caacaatccttttcaaagtttatcgataatttcactttcca |
36328302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 48 - 127
Target Start/End: Complemental strand, 36337082 - 36337002
Alignment:
| Q |
48 |
atttcataatttgtttggaaccctagccgccgttttcttctttaactatcctctcttttactattgtta-acactttcatc |
127 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||| |||| |||| ||||| ||||||| ||||||| | ||||||||||| |
|
|
| T |
36337082 |
atttcataacttgtttggaaccctagccgtcgtcttctcctttcactattaactctttttctattgtcagacactttcatc |
36337002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University