View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_high_212 (Length: 251)
Name: NF0928_high_212
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0928_high_212 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 15 - 237
Target Start/End: Complemental strand, 47126565 - 47126343
Alignment:
| Q |
15 |
gacccaagtttgaagaacagaaatgggccagtgaaattgccatatacccttctgtttcccaatacctctgattattctagggagggtggactcactggta |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47126565 |
gacccaagtttgaagaacagaaatgggccagtgaaattgccttatacccttctgtttcccaatacctctgattattctagggagggtggactcactggta |
47126466 |
T |
 |
| Q |
115 |
agggaattcccaacagcatatccatctgaaaccattctctttgaattcttgctatttatctaaccaaagacttagctttggtatcgaataaactatgtat |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
47126465 |
agggaattcccaacagcatatccatctgaaaccattctctttgaatttttgctatttatctaaccaaagacttagctttggtgtcgaataaactatgtat |
47126366 |
T |
 |
| Q |
215 |
caccgacactttagattgaaggt |
237 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
47126365 |
caccgacactttagattgaaggt |
47126343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University