View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0928_high_216 (Length: 250)

Name: NF0928_high_216
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0928_high_216
NF0928_high_216
[»] chr7 (1 HSPs)
chr7 (21-112)||(15639075-15639166)


Alignment Details
Target: chr7 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 21 - 112
Target Start/End: Original strand, 15639075 - 15639166
Alignment:
21 tattcatagaaatcataattaaatgaatttgagagtaaactgtttgaggataatttatgcatattcataacaaactacaccaagaaagtata 112  Q
    |||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||    
15639075 tattcatagaaatcataattcaatgaatttgagagtaaacggtttgaggataatttatgcatattcataataaactacaccaagaaagtata 15639166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University